| ROUGE |
Gene/Protein Characteristic Table for mKIAA4093 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220483 |
|---|---|
| Dynamin-1. | |
| mfj26207 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3222 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 604 bp Genome contig ID gi66880554r_32140639 PolyA signal sequence
(AATAAA,-24)
TCTTGGCTGAGAATAAAACCCATTTCTGGATCATGFlanking genome sequence
(100000 - 99951)
GGGAATTGCGTGTACCTCTGCTGGTTTGTATTCTCTGGGGCTGAGAGGAC
Features of the protein sequence |
Description | |
Coding region: 3..2615
Length: 871 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR001401 | 51 | 69 | PR00195 | Dynamin |
| IPR001401 | 76 | 93 | PR00195 | Dynamin | |
| IPR001401 | 146 | 163 | PR00195 | Dynamin | |
| IPR001401 | 196 | 214 | PR00195 | Dynamin | |
| IPR001401 | 215 | 231 | PR00195 | Dynamin | |
| IPR001401 | 238 | 257 | PR00195 | Dynamin | |
| HMMPfam | IPR001401 | 54 | 227 | PF00350 | Dynamin |
| IPR000375 | 236 | 529 | PF01031 | Dynamin central region | |
| IPR001849 | 540 | 645 | PF00169 | Pleckstrin-like | |
| IPR003130 | 674 | 765 | PF02212 | Dynamin GTPase effector | |
| HMMSmart | IPR001401 | 26 | 265 | SM00053 | Dynamin |
| IPR001849 | 540 | 647 | SM00233 | Pleckstrin-like | |
| IPR003130 | 674 | 765 | SM00302 | Dynamin GTPase effector | |
| ProfileScan | IPR001849 | 539 | 645 | PS50003 | Pleckstrin-like |
| IPR000694 | 773 | 864 | PS50099 | Proline-rich region | |
| ScanRegExp | IPR001401 | 77 | 86 | PS00410 | Dynamin |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
