ROUGE |
Gene/Protein Characteristic Table for mKIAA4066 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220284 |
---|---|
ectonucleoside triphosphate diphosphohydrolase. lysosomal apyrase-like 2. |
|
mid11058 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3085 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2744 bp Genome contig ID gi65553144f_43172456 PolyA signal sequence
(TATAAA,-23) +----*----+----*----+----*----+----
ATCATTTCTCAATATAAATATATTTCTTAATTTATFlanking genome sequence
(104630 - 104679) ----+----*----+----*----+----*----+----*----+----*
TTTAATTAGTCTTTGAGTTTCTGTTTGGTGCATTGTATCCTGTTTATTGC
Features of the protein sequence |
Description | |
Coding region: 3..338
Length: 112 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |