ROUGE

Gene/Protein Characteristic Table for mKIAA4057

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220463
Description :	Ubiquitously transcribed Y chromosome tetratricopeptide repeat protein.
Clone Name :	mbg02624 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1515 bp

Genome contig ID gi65554999r_333589
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GACTTACGCATTAAAATTTATTATTAGTAAATCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAAGGTCTATGAAGGCTTTATTTCATATTTTTACTTAAAAGCTTAGTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1518..3665
Length: 716 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE25094	100.0	unnamed protein...	Mus musculus
AAI40404	100.0	Ubiquitously tr...	synthetic construct
EDL38146	100.0	ubiquitously tr...	Mus musculus
BAE37965	99.9	unnamed protein...	Mus musculus
BAE36901	99.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129121	1.2e-84	62.7	mKIAA0346

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003347 487 595 PF02373 Transcription factor jumonji

ProfileScan IPR000694 273 295 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003347	487	595	PF02373	Transcription factor jumonji
ProfileScan	IPR000694	273	295	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1515 bp
Genome contig ID	gi65554999r_333589
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GACTTACGCATTAAAATTTATTATTAGTAAATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAAGGTCTATGAAGGCTTTATTTCATATTTTTACTTAAAAGCTTAGTT

Gene/Protein Characteristic Table for mKIAA4057

Features of the cloned DNA sequence

Features of the protein sequence