ROUGE

Gene/Protein Characteristic Table for mKIAA4042

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220453
Description :
Clone Name :	mfj56269 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 5012 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4193 bp

Genome contig ID gi65488608r_34982564
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AGTTTTCAATAAAGATTGACTTGTGTTGCATATTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGACCTTTTCGTGGGAGTGTTTTCAGAGGGACGGTCTCACTAGCACTTGC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 34..816
Length: 261 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80XQ8	9.4e-56	100.0	UPF0541 protein...	Mus musculus
BAE25820	2.4e-55	99.5	unnamed protein...	Mus musculus
AAI10643	3.5e-54	97.9	FAM168B protein...	Homo sapiens
XP_422581	4.8e-54	96.4	hypothetical pr...	Gallus gallus
XP_001915297	9.7e-52	92.8	hypothetical pr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122235	1.3e-17	66.9	mKIAA0280

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4193 bp
Genome contig ID	gi65488608r_34982564
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGTTTTCAATAAAGATTGACTTGTGTTGCATATTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGACCTTTTCGTGGGAGTGTTTTCAGAGGGACGGTCTCACTAGCACTTGC

Gene/Protein Characteristic Table for mKIAA4042

Features of the cloned DNA sequence

Features of the protein sequence