ROUGE |
Gene/Protein Characteristic Table for mKIAA4031 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220450 |
---|---|
Mitogen-activated protein kinase kinase kinase 3. | |
mbh03479 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4037 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2635 bp Genome contig ID gi65527427f_105805698 PolyA signal sequence
(ATTAAA,-13) +----*----+----*----+----*----+----
TCCCAAATTTTTGGGAGTTATCATTAAAGGAAAGGFlanking genome sequence
(170826 - 170875) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAGCCAGTGCCCAGGGATGGGCATCTCCAGGGAGC
Features of the protein sequence |
Description | |
Coding region: 278..1399
Length: 374 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |