| ROUGE |
Gene/Protein Characteristic Table for mKIAA4028 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220277 |
|---|---|
| Growth factor receptor-bound protein 7. | |
| mid25067 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2286 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 366 bp Genome contig ID gi65527427f_98168156 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTTTATACCAGTAGCAATAAAGATTATTTTTTGATFlanking genome sequence
(108304 - 108353) ----+----*----+----*----+----*----+----*----+----*
ACATCTGTGAGTCCTGTCTGGCAAGAACATGTCAGAGAACCAGCAGAGGT
Features of the protein sequence |
Description | |
Coding region: 865..1917
Length: 351 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |