ROUGE |
Gene/Protein Characteristic Table for mKIAA4022 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK053665 |
---|---|
Loss of heterozygosity 11 chromosomal region 2 gene A protein homolog. | |
mid01018 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3355 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 815 bp Genome contig ID gi65519420f_38560928 PolyA signal sequence
(AAGAAA,-12) +----*----+----*----+----*----+----
TGGACATTTCATGGTCAGAGAACAAGAAAAATGGCFlanking genome sequence
(124269 - 124318) ----+----*----+----*----+----*----+----*----+----*
AACATTGGCTAACATGAATCTCACTGAGGCTGGACTGCTCCTGATTGACT
Features of the protein sequence |
Description | |
Coding region: 144..2537
Length: 798 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |