ROUGE

Gene/Protein Characteristic Table for mKIAA4006

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220163
Description :	Serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, epsilon isoform (Fragment).
Clone Name :	mpj03492 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1871 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65532617r_72216051
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGACAGCCACATACAAGTCAGATCGTCAGCGTGAG
Flanking genome sequence
(99999 - 99950)
----+----*----+----*----+----*----+----*----+----*
TAACTTTTTAAAGCTCTTTTGTCTGCTGTGCAGAAAGCTATGAGTCCTAC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 366..1868
Length: 502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93048	3.1e-132	94.1	epsilon isoform...	Homo sapiens
Q61151	2.9e-127	100.0	Serine/threonin...	Mus musculus
AAH64358	3.9e-127	99.8	PPP2R5E protein...	Homo sapiens
Q16537	4e-127	99.8	Serine/threonin...	Homo sapiens
AAH92477	6.9e-127	99.5	Protein phospha...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129042	2e-51	63.6	mKIAA0044

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002554 113 502 PF01603 Protein phosphatase 2A

ProfileScan IPR000694 23 49 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002554	113	502	PF01603	Protein phosphatase 2A
ProfileScan	IPR000694	23	49	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi65532617r_72216051
PolyA signal sequence (None)	+--------+--------+----*----+---- TGACAGCCACATACAAGTCAGATCGTCAGCGTGAG
Flanking genome sequence (99999 - 99950)	----+--------+--------+--------+--------+----* TAACTTTTTAAAGCTCTTTTGTCTGCTGTGCAGAAAGCTATGAGTCCTAC

Gene/Protein Characteristic Table for mKIAA4006

Features of the cloned DNA sequence

Features of the protein sequence