ROUGE

Gene/Protein Characteristic Table for mKIAA4003

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220442
Description :	DNA replication licensing factor MCM4.
Clone Name :	mfj10260 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3283 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 572 bp

Genome contig ID gi65546577r_14293174
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGTAAAACATTTTCCTAAATAAATGATAGAAAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATACTTGGTTTAAAATTATTTCTCATTAAGAGCAGAACTTTGCTAAAGA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 678..2708
Length: 677 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P49717	100.0	DNA replication...	Mus musculus
BAC41036	99.7	unnamed protein...	Mus musculus
BAE30450	99.8	unnamed protein...	Mus musculus
AAH13094	99.8	Minichromosome ...	Mus musculus
BAB27813	99.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129039	2.9e-37	35.7	mKIAA0030

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001208 238 304 PD001041 MCM

HMMPfam IPR001208 259 584 PF00493 MCM

IPR000523 305 472 PF01078 Magnesium chelatase

HMMSmart IPR001208 81 584 SM00350 MCM

ProfileScan IPR001208 272 480 PS50051 MCM

ScanRegExp IPR001208 383 391 PS00847 MCM

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001208	238	304	PD001041	MCM
HMMPfam	IPR001208	259	584	PF00493	MCM
IPR000523	305	472	PF01078	Magnesium chelatase
HMMSmart	IPR001208	81	584	SM00350	MCM
ProfileScan	IPR001208	272	480	PS50051	MCM
ScanRegExp	IPR001208	383	391	PS00847	MCM

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	572 bp
Genome contig ID	gi65546577r_14293174
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTAAAACATTTTCCTAAATAAATGATAGAAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACTTGGTTTAAAATTATTTCTCATTAAGAGCAGAACTTTGCTAAAGA

Gene/Protein Characteristic Table for mKIAA4003

Features of the cloned DNA sequence

Features of the protein sequence