ROUGE

Gene/Protein Characteristic Table for mKIAA4002

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220441
Description :	Transcription factor-like protein MRG15.
Clone Name :	mfj03141 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4640 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 647 bp

Genome contig ID gi65519420r_89879041
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTCAGATCTTCAATAAATTTTTTCTTTAAATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAGATTGTGTGGCCGTGTTATCAAGATTTTGATTTTGACACATTGTAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3337..3990
Length: 218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE29963	1.5e-85	100.0	unnamed protein...	Mus musculus
BAE32082	2.4e-85	100.0	unnamed protein...	Mus musculus
BAC37546	2.5e-85	100.0	unnamed protein...	Mus musculus
AAI21094	2.6e-85	100.0	MORF4L1 protein...	Homo sapiens
BAE73056	2.6e-85	100.0	hypothetical pr...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129038	1.4e-66	86.5	mKIAA0026

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008676 2 206 PF05712 MRG

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008676	2	206	PF05712	MRG

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	647 bp
Genome contig ID	gi65519420r_89879041
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTCAGATCTTCAATAAATTTTTTCTTTAAATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAGATTGTGTGGCCGTGTTATCAAGATTTTGATTTTGACACATTGTAT

Gene/Protein Characteristic Table for mKIAA4002

Features of the cloned DNA sequence

Features of the protein sequence