ROUGE |
Gene/Protein Characteristic Table for mKIAA3013 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129478 |
---|---|
mpm01086 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5592 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1132 bp Genome contig ID gi65543215r_96381150 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
ATAATAAATAAAGAAGTTCCCTAATGGTTACAGTGFlanking genome sequence
(99805 - 99756) ----+----*----+----*----+----*----+----*----+----*
AATAAAGTGTTAATTTGTTGATTGGTAGCTCTGCTGCATAATTCTAGATA
Features of the protein sequence |
Description | |
Coding region: 75..4457
Length: 1461 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |