ROUGE

Gene/Protein Characteristic Table for mKIAA3007

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129475
Description :
Clone Name :	mph02465 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3743 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1270 bp

Genome contig ID gi65492966f_58557423
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTGTGCATTAATCTTTGCTAGGTTAAGTTTAGC
Flanking genome sequence
(209133 - 209182)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAGAAGTTGAATTCTATTTTACTTGACCTAACTTC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 269..2470
Length: 734 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL35346	100.0	mCG13096, isofo...	Mus musculus
BAC31219	100.0	unnamed protein...	Mus musculus
Q8BQM9	98.5	Mediator of RNA...	Mus musculus
AAL09579	95.2	NOPAR [Homo sap...	Homo sapiens
Q86YW9	95.2	Mediator of RNA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1270 bp
Genome contig ID	gi65492966f_58557423
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTTGTGCATTAATCTTTGCTAGGTTAAGTTTAGC
Flanking genome sequence (209133 - 209182)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAGAAGTTGAATTCTATTTTACTTGACCTAACTTC

Gene/Protein Characteristic Table for mKIAA3007

Features of the cloned DNA sequence

Features of the protein sequence