ROUGE

Gene/Protein Characteristic Table for mKIAA2037

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220225
Description :
Clone Name :	msh10203 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 4451 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2035 bp

Genome contig ID gi65498774r_99360681
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AATCATACAGAAAATAAACATTTATACTATTCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGTTTTGCATTTTTTCTTTAGTTTAACAATACCAGTTTTAACC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2037 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2037	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 35..2416
Length: 793 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q571G4	100.0	Protein lin-54 ...	Mus musculus
Q641Z1	98.4	Protein lin-54 ...	Rattus norvegicus
XP_535631	95.9	similar to meta...	Canis lupus fam...
EAX05917	96.7	hypothetical pr...	Homo sapiens
Q6MZP7	96.5	Protein lin-54 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005172 564 604 PF03638 Tesmin/TSO1-like

IPR005172 638 679 PF03638 Tesmin/TSO1-like

ProfileScan NULL 569 673 PS50311 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005172	564	604	PF03638	Tesmin/TSO1-like
IPR005172	638	679	PF03638	Tesmin/TSO1-like
ProfileScan	NULL	569	673	PS50311	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2035 bp
Genome contig ID	gi65498774r_99360681
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATCATACAGAAAATAAACATTTATACTATTCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAGTTTTGCATTTTTTCTTTAGTTTAACAATACCAGTTTTAACC

Gene/Protein Characteristic Table for mKIAA2037

Features of the cloned DNA sequence

Features of the protein sequence