ROUGE

Gene/Protein Characteristic Table for mKIAA2024

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173334
Description :
Clone Name :	mbg01868 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5392 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4587 bp

Genome contig ID gi66880554f_69758807
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAACCTACTGTCATTTGCTTTGTGCAAGATCCTT
Flanking genome sequence
(120605 - 120654)
----+----*----+----*----+----*----+----*----+----*
ATAATGTTGAATGTTTATGTTTTCTTTTCCAATGATATTGAGAATGACAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2024 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2024	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..805
Length: 267 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH85286	1.3e-107	100.0	Ubr3 protein [M...	Mus musculus
AAI57931	2.5e-107	100.0	Ubr3 protein [M...	Mus musculus
EDL27056	3.9e-107	100.0	RIKEN cDNA A130...	Mus musculus
ABK59000	4.2e-107	100.0	ubiquitin ligas...	Mus musculus
Q5U430	4.2e-107	100.0	E3 ubiquitin-pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4587 bp
Genome contig ID	gi66880554f_69758807
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAACCTACTGTCATTTGCTTTGTGCAAGATCCTT
Flanking genome sequence (120605 - 120654)	----+--------+--------+--------+--------+----* ATAATGTTGAATGTTTATGTTTTCTTTTCCAATGATATTGAGAATGACAT

Gene/Protein Characteristic Table for mKIAA2024

Features of the cloned DNA sequence

Features of the protein sequence