ROUGE

Gene/Protein Characteristic Table for mKIAA2021

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK032873
Description :
Clone Name :	mnh06352 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2207 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 263 bp

Genome contig ID gi65540054f_50163758
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGACATACTGGTAAAGACTTTTGTATTTTTCTTGG
Flanking genome sequence
(108322 - 108371)
----+----*----+----*----+----*----+----*----+----*
AAATATTTTTATTTTATTTTTTAGGGGAAAGTTATCTTGTAGTAAAGCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2021 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2021	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 13..1944
Length: 643 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BMC4	100.0	Pumilio domain-...	Mus musculus
AAH18523	99.8	RIKEN cDNA 2610...	Mus musculus
BAE31453	99.8	unnamed protein...	Mus musculus
BAC29882	99.8	unnamed protein...	Mus musculus
BAB27705	99.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001313 196 227 SM00025 Pumilio/Puf RNA-binding

IPR001313 321 356 SM00025 Pumilio/Puf RNA-binding

IPR001313 358 394 SM00025 Pumilio/Puf RNA-binding

IPR001313 516 553 SM00025 Pumilio/Puf RNA-binding

IPR001313 554 589 SM00025 Pumilio/Puf RNA-binding

ProfileScan IPR001313 87 611 PS50302 Pumilio/Puf RNA-binding

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001313	196	227	SM00025	Pumilio/Puf RNA-binding
IPR001313	321	356	SM00025	Pumilio/Puf RNA-binding
IPR001313	358	394	SM00025	Pumilio/Puf RNA-binding
IPR001313	516	553	SM00025	Pumilio/Puf RNA-binding
IPR001313	554	589	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	87	611	PS50302	Pumilio/Puf RNA-binding

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	263 bp
Genome contig ID	gi65540054f_50163758
PolyA signal sequence (None)	+--------+--------+----*----+---- AGACATACTGGTAAAGACTTTTGTATTTTTCTTGG
Flanking genome sequence (108322 - 108371)	----+--------+--------+--------+--------+----* AAATATTTTTATTTTATTTTTTAGGGGAAAGTTATCTTGTAGTAAAGCTA

Gene/Protein Characteristic Table for mKIAA2021

Features of the cloned DNA sequence

Features of the protein sequence