ROUGE

Gene/Protein Characteristic Table for mKIAA2009

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173330
Description :
Clone Name :	mph00181 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3435 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 573 bp

Genome contig ID gi65511124f_76623872
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAAAGTTAAAACTGTAACATATCTCTTATATATT
Flanking genome sequence
(103436 - 103485)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAACCTTTAAAAGTTTTAAAGAGAAATTGCATTAATACAGAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2009 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2009	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..612, 1366..2862
Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q69Z36	1.4e-174	100.0	RNA-binding pro...	Mus musculus
XP_917553	1.1e-144	84.2	similar to RNA-...	Mus musculus
EDL06891	8.7e-144	98.4	mCG8258 [Mus mu...	Mus musculus
XP_620516	1.7e-138	95.8	ring finger and...	Mus musculus
XP_218846	1.3e-137	95.7	similar to ring...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004088 175 260 PF00013 KH

IPR004088 295 354 PF00013 KH

IPR001841 651 690 PF00097 Zinc finger

HMMSmart IPR004087 172 265 SM00322 KH

IPR004087 292 359 SM00322 KH

IPR001841 651 690 SM00184 Zinc finger

ProfileScan NULL 94 133 PS50315 NULL

IPR004088 293 354 PS50084 KH

NULL 525 553 PS50324 NULL

NULL 620 641 PS50324 NULL

IPR001841 651 691 PS50089 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	175	260	PF00013	KH
IPR004088	295	354	PF00013	KH
IPR001841	651	690	PF00097	Zinc finger
HMMSmart	IPR004087	172	265	SM00322	KH
IPR004087	292	359	SM00322	KH
IPR001841	651	690	SM00184	Zinc finger
ProfileScan	NULL	94	133	PS50315	NULL
IPR004088	293	354	PS50084	KH
NULL	525	553	PS50324	NULL
NULL	620	641	PS50324	NULL
IPR001841	651	691	PS50089	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	573 bp
Genome contig ID	gi65511124f_76623872
PolyA signal sequence (None)	+--------+--------+----*----+---- TTAAAGTTAAAACTGTAACATATCTCTTATATATT
Flanking genome sequence (103436 - 103485)	----+--------+--------+--------+--------+----* AAAAAAAAAAACCTTTAAAAGTTTTAAAGAGAAATTGCATTAATACAGAT

Gene/Protein Characteristic Table for mKIAA2009

Features of the cloned DNA sequence

Features of the protein sequence