ROUGE

Gene/Protein Characteristic Table for mKIAA1992

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173320
Description :
Clone Name :	mpm01240 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4576 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 441 bp

Genome contig ID gi66880554r_65939729
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTAAATGTATATTTTAATAAAGATTTTTGTGAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTGGTTTATATTTTTTCAGAACTCAAAAGACACAGGGCAGTCTGCAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1992 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1992	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3488..4135
Length: 215 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE21052	5.7e-75	86.0	unnamed protein...	Mus musculus
Q0HA38	9.9e-75	86.0	Tetratricopepti...	Mus musculus
XP_229983	1.6e-73	85.1	similar to tetr...	Rattus norvegicus
XP_001496187	7.3e-70	80.6	similar to tetr...	Equus caballus
AAI51354	6.6e-69	78.9	TTC21B protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001440 96 129 PF00515 TPR repeat

IPR001440 165 198 PF00515 TPR repeat

ProfileScan IPR001440 96 198 PS50293 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	96	129	PF00515	TPR repeat
IPR001440	165	198	PF00515	TPR repeat
ProfileScan	IPR001440	96	198	PS50293	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	441 bp
Genome contig ID	gi66880554r_65939729
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTAAATGTATATTTTAATAAAGATTTTTGTGAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGGTTTATATTTTTTCAGAACTCAAAAGACACAGGGCAGTCTGCAGT

Gene/Protein Characteristic Table for mKIAA1992

Features of the cloned DNA sequence

Features of the protein sequence