ROUGE

Gene/Protein Characteristic Table for mKIAA1974

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129470
Description :	aminopeptidase-like 1.
Clone Name :	mpk00325 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1284 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 448 bp

Genome contig ID gi66880554f_173445470
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTCACTTGAAGTTGAATTAAATATGGCCACAACAT
Flanking genome sequence
(102140 - 102189)
----+----*----+----*----+----*----+----*----+----*
AACCTTGTCTCCGCTCACTTTTTTTCTCAACTTCTTTGTCTTACTTCTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1974 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1974	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 387..836
Length: 149 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH80707	1.4e-66	100.0	Npepl1 protein ...	Mus musculus
BAE29459	1.5e-66	100.0	unnamed protein...	Mus musculus
BAE41846	1.5e-66	100.0	unnamed protein...	Mus musculus
Q6NSR8	1.5e-66	100.0	Probable aminop...	Mus musculus
EDL06661	1.5e-66	100.0	aminopeptidase-...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR000408 2 12 PS00626 Regulator of chromosome condensation

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000408	2	12	PS00626	Regulator of chromosome condensation

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	448 bp
Genome contig ID	gi66880554f_173445470
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTCACTTGAAGTTGAATTAAATATGGCCACAACAT
Flanking genome sequence (102140 - 102189)	----+--------+--------+--------+--------+----* AACCTTGTCTCCGCTCACTTTTTTTCTCAACTTCTTTGTCTTACTTCTTT

Gene/Protein Characteristic Table for mKIAA1974

Features of the cloned DNA sequence

Features of the protein sequence