ROUGE

Gene/Protein Characteristic Table for mKIAA1968

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129468
Description :	Similar to AT-hook transcription factor AKNA (Fragment).
Clone Name :	mpf00214 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5948 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2407 bp

Genome contig ID gi65493515r_62351938
PolyA signal sequence
(TATAAA,-32)
+----*----+----*----+----*----+----
TGTTATAAAAGCAAATGATGGAAAATAATGAACTT
Flanking genome sequence
(242617 - 242568)
----+----*----+----*----+----*----+----*----+----*
GACTTTTACTGCTTTTACATGTGTTCGGGAGACTTGAACTCGGGTCGTCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1968 DNA sequence, Physical map

KIAA	Alignment based on:
KIAA1968	DNA sequence, Physical map

Features of the protein sequence	Description

Coding region: 239..3538
Length: 1100 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q80VW7	0	86.6	AT-hook-contain...	Mus musculus
BAE32751	0	83.7	unnamed protein...	Mus musculus
EDM10525	0	73.9	AT-hook transcr...	Rattus norvegicus
AAH36324	1.4e-158	97.8	Akna protein [M...	Mus musculus
AAH25835	2.4e-148	100.0	Akna protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR005829 973 989 PS00216 Sugar transporter superfamily

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR005829	973	989	PS00216	Sugar transporter superfamily

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2407 bp
Genome contig ID	gi65493515r_62351938
PolyA signal sequence (TATAAA,-32)	+--------+--------+----*----+---- TGTTATAAAAGCAAATGATGGAAAATAATGAACTT
Flanking genome sequence (242617 - 242568)	----+--------+--------+--------+--------+----* GACTTTTACTGCTTTTACATGTGTTCGGGAGACTTGAACTCGGGTCGTCA

Gene/Protein Characteristic Table for mKIAA1968

Features of the cloned DNA sequence

Features of the protein sequence