ROUGE

Gene/Protein Characteristic Table for mKIAA1952

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173309
Description :	BM6H1.1 (Fragment).
Clone Name :	mek00570 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 956 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 26 bp

Genome contig ID gi65493515f_62124108
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGCTTTAAGACTCAACTTTGAGGGAAAAAAAGAC
Flanking genome sequence
(100957 - 101006)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACAAGAAAAACATTAGGAACACACACAACACTGTCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1952 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1952	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..930
Length: 309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_915675	1.2e-131	100.0	similar to zinc...	Mus musculus
XP_001473246	1.2e-131	100.0	zinc finger pro...	Mus musculus
Q80YY7	1.3e-131	100.0	Zinc finger pro...	Mus musculus
XP_233016	2.8e-130	98.7	similar to zinc...	Rattus norvegicus
XP_001097368	1.4e-129	98.4	similar to zinc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008906 228 308 PF05699 HAT dimerisation

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008906	228	308	PF05699	HAT dimerisation

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	26 bp
Genome contig ID	gi65493515f_62124108
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGCTTTAAGACTCAACTTTGAGGGAAAAAAAGAC
Flanking genome sequence (100957 - 101006)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACAAGAAAAACATTAGGAACACACACAACACTGTCAC

Gene/Protein Characteristic Table for mKIAA1952

Features of the cloned DNA sequence

Features of the protein sequence