Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07502 |
---|---|
Accession No | AB075832 |
Description | zinc finger protein 618 |
Clone name | fj14047 |
Vector information | |
cDNA sequence | DNA sequence (2894 bp) Predicted protein sequence (735 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1952
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 16 bp |
---|---|
Genome contig ID | gi89161216f_115730022 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (122264 - 122313) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 115830022 | 115852284 | 6 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR008906 | 654 | 734 | PF05699 | HAT dimerisation |
ProfileScan | IPR007087 | 173 | 200 | PS50157 | Zinc finger |
ScanRegExp | IPR007087 | 175 | 195 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | AACACCCAACAGCATGATCCC |
---|---|
Primer_r | CCCAGGATTTCAGTGACCGAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |