ROUGE

Gene/Protein Characteristic Table for mKIAA1949

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK051656
Description :
Clone Name :	msk03095 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 1347 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 781 bp

Genome contig ID gi65550231f_33486606
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CTTTCCATAATAAAATGGAGCTCTTTTCAACTCTC
Flanking genome sequence
(108077 - 108126)
----+----*----+----*----+----*----+----*----+----*
TTGCTGCCTTCCTTTGTTTCTTTTTTTAAAAGATTTTGTTTTGGGGCTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1949 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1949	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..566
Length: 187 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE32879	1.3e-59	100.0	unnamed protein...	Mus musculus
EDL23241	2.8e-59	100.0	mCG141149, isof...	Mus musculus
Q8BQ30	2.8e-59	100.0	Phostensin; Pro...	Mus musculus
AAI50726	2.8e-59	100.0	2310014H01Rik p...	Mus musculus
AAI45184	6.7e-59	99.5	2310014H01Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 1 64 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	1	64	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	781 bp
Genome contig ID	gi65550231f_33486606
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTTTCCATAATAAAATGGAGCTCTTTTCAACTCTC
Flanking genome sequence (108077 - 108126)	----+--------+--------+--------+--------+----* TTGCTGCCTTCCTTTGTTTCTTTTTTTAAAAGATTTTGTTTTGGGGCTGG

Gene/Protein Characteristic Table for mKIAA1949

Features of the cloned DNA sequence

Features of the protein sequence