ROUGE

Gene/Protein Characteristic Table for mKIAA1936

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173306
Description :	SET and MYND domain containing 4.
Clone Name :	mef00064 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 767 bp

Genome contig ID gi65527427f_75013068
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTGAATGGAGAAATAAATACGTCTTACTGTTGGC
Flanking genome sequence
(118279 - 118328)
----+----*----+----*----+----*----+----*----+----*
AGTTTCTTCCTGGGATGGCAACTCTGTATTGGTTTCCTACCAGTGTCCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1936 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1936	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2153
Length: 716 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8BTK5	100.0	SET and MYND do...	Mus musculus
EDL12802	100.0	SET and MYND do...	Mus musculus
BAC41013	99.9	unnamed protein...	Mus musculus
AAH95952	99.0	Smyd4 protein [...	Mus musculus
EDL12801	100.0	SET and MYND do...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002893 213 252 PF01753 Zinc finger

ProfileScan IPR001214 450 491 PS50280 Nuclear protein SET

ScanRegExp IPR002893 213 252 PS01360 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002893	213	252	PF01753	Zinc finger
ProfileScan	IPR001214	450	491	PS50280	Nuclear protein SET
ScanRegExp	IPR002893	213	252	PS01360	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	767 bp
Genome contig ID	gi65527427f_75013068
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTGAATGGAGAAATAAATACGTCTTACTGTTGGC
Flanking genome sequence (118279 - 118328)	----+--------+--------+--------+--------+----* AGTTTCTTCCTGGGATGGCAACTCTGTATTGGTTTCCTACCAGTGTCCTA

Gene/Protein Characteristic Table for mKIAA1936

Features of the cloned DNA sequence

Features of the protein sequence