KIAA1936

Product ID	ORK06911
Accession No	AB067523
Description	SET and MYND domain containing 4
Clone name	fk03674
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3016 bp) Predicted protein sequence (558 aa)
Source	Human fetal brain
Rouge ID	mKIAA1936 by Kazusa Mouse cDNA Project

Length: 3016 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1339 bp
Genome contig ID	gi51511734r_1531875
PolyA signal sequence (None)	+--------+--------+----*----+---- AAATACCTGGGCGACAAGAGTGAAACTCTTGTCTC
Flanking genome sequence (99861 - 99812)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCTTTGAGATTTGCCTCGTGTTCTCAGGATCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	1631736	1650849	6	99.1	Perfect prediction

Length: 558 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW90576	99.6	SET and MYND do...	Homo sapiens
Q8IYR2	99.6	SET and MYND do...	Homo sapiens
AAH35077	99.5	SET and MYND do...	Homo sapiens
NP_443160	99.5	SET and MYND do...	Homo sapiens
BAC04538	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002893	100	139	PF01753	Zinc finger
ProfileScan	IPR002893	100	139	PS50865	Zinc finger
ProfileScan	IPR001214	341	382	PS50280	SET
ScanRegExp	IPR002893	100	139	PS01360	Zinc finger

Primer_f	ATAGCCCAGAGCACAAATTCC
Primer_r	TGAAGCTGTAACATGTGTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-