Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06911 |
---|---|
Accession No | AB067523 |
Description | SET and MYND domain containing 4 |
Clone name | fk03674 |
Vector information | |
cDNA sequence | DNA sequence (3016 bp) Predicted protein sequence (558 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1936
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 1339 bp |
---|---|
Genome contig ID | gi51511734r_1531875 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99861 - 99812) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 1631736 | 1650849 | 6 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
RT-PCR-ELISA |
Primer_f | ATAGCCCAGAGCACAAATTCC |
---|---|
Primer_r | TGAAGCTGTAACATGTGTCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |