ROUGE

Gene/Protein Characteristic Table for mKIAA1899

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173291
Description :	tubulin, gamma complex associated protein 5.
Clone Name :	mph04252 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3055 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 556 bp

Genome contig ID gi65511124f_49963675
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CCAGTAATATCTCAAATAAAAGTATGTATATCATC
Flanking genome sequence
(137249 - 137298)
----+----*----+----*----+----*----+----*----+----*
CCATTTTTCTACCTATTTCATGTGTATTTCTTAGTGGGCACTGTATGATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1899 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1899	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..511, 523..2499
Length: 828 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH27075	97.5	Tubgcp5 protein...	Mus musculus
Q8BKN5	80.8	Gamma-tubulin c...	Mus musculus
BAC27661	80.7	unnamed protein...	Mus musculus
EDL21879	80.9	tubulin, gamma ...	Mus musculus
BAC34603	80.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122256	0.00015	24.9	mKIAA0357

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007259 109 718 PF04130 Spc97/Spc98

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007259	109	718	PF04130	Spc97/Spc98

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	556 bp
Genome contig ID	gi65511124f_49963675
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCAGTAATATCTCAAATAAAAGTATGTATATCATC
Flanking genome sequence (137249 - 137298)	----+--------+--------+--------+--------+----* CCATTTTTCTACCTATTTCATGTGTATTTCTTAGTGGGCACTGTATGATA

Gene/Protein Characteristic Table for mKIAA1899

Features of the cloned DNA sequence

Features of the protein sequence