ROUGE |
Gene/Protein Characteristic Table for mKIAA1892 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173289 |
---|---|
WD repeat domain 40A. | |
mfj27275 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3311 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1753 bp Genome contig ID gi65493515r_41330155 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTTTTGCCAAGGAAAAATAAATACTATCCCAGTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGAGCTGTTTGAGTGACTATATATGGCAAAGATGCTGCAGGGAGCAGACC
KIAA Alignment based on: KIAA1892 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 128..1558
Length: 476 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |