| ROUGE | 
Gene/Protein Characteristic Table for mKIAA1856 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173280 | 
|---|---|
| zinc finger protein 469. | |
| mpg00441 [Vector Info] | |
| Source : | Mouse embryonic tail | 
Features of the cloned DNA sequence | 
Description | |
|---|---|---|
Length: 4963 bp
 
       | 
| cloned DNA seq. | |
Warning for N-terminal truncation:  | YES | 
Warning for coding interruption:  | YES | 
Length of 3'UTR 2240 bp Genome contig ID gi65498774r_141637098 PolyA signal sequence 
(AAGAAA,-18) +----*----+----*----+----*----+----
AGGAAAGAAAAAGAGAAAAGAAAAAATTTAATTGGFlanking genome sequence 
(99953 - 99904) ----+----*----+----*----+----*----+----*----+----*
AAAAATACTATGTCTTTGGAGTGACTTATTTTGGGGTCCTGGAGTGAATG
KIAA Alignment based on: KIAA1856 DNA sequence, AA sequence, Physical map 
Features of the protein sequence | 
Description | |
Coding region: 3..2684, 3088..3594
Length: 1062 aa
![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
    | 
 
 How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage  
 
  | |