Gene/Protein Characteristic Table for KIAA1856
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07176
Accession No AB058759
Description trinucleotide repeat containing 18
Clone name fh03203
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5223 bp)
Predicted protein sequence (1134 aa)
Source Human fetal brain
Rouge ID mKIAA1856 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5223 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 1818 bp
Genome contig ID gi89161213r_5212951
PolyA signal sequence
(CATAAA,-34)
+----*----+----*----+----*----+----
TCATAAAAAAAAAGAAAAGATTTAATTGGAAAAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTGTCTGGAGTGGTTTATTTCAGGGGCTGGAGTAGGGGTGGTGTCT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 r 5312951 5377384 14 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1134 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15417 0 99.9 Trinucleotide r...
Homo sapiens
EAW87331 1.7e-213 98.8 hCG96198, isofo...
Homo sapiens
EAW87332 1.7e-213 98.8 hCG96198, isofo...
Homo sapiens
XP_876015 1.4e-181 83.9 similar to hCG9...
Bos taurus
EDL19086 2.5e-167 78.2 zinc finger pro...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan NULL 947 959 PR01217 NULL
NULL 962 978 PR01217 NULL
NULL 983 995 PR01217 NULL
NULL 1002 1023 PR01217 NULL
NULL 1036 1052 PR01217 NULL
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAGACTTGGGATGAACATGAG
Primer_r CCAGCACTGTCCGAAAACTTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp