KIAA1856

Product ID	ORK07176
Accession No	AB058759
Description	trinucleotide repeat containing 18
Clone name	fh03203
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5223 bp) Predicted protein sequence (1134 aa)
Source	Human fetal brain
Rouge ID	mKIAA1856 by Kazusa Mouse cDNA Project

Length: 5223 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1818 bp
Genome contig ID	gi89161213r_5212951
PolyA signal sequence (CATAAA,-34)	+--------+--------+----*----+---- TCATAAAAAAAAAGAAAAGATTTAATTGGAAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTGTCTGGAGTGGTTTATTTCAGGGGCTGGAGTAGGGGTGGTGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	5312951	5377384	14	99.8	Perfect prediction

Length: 1134 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O15417	0	99.9	Trinucleotide r...	Homo sapiens
EAW87331	1.7e-213	98.8	hCG96198, isofo...	Homo sapiens
EAW87332	1.7e-213	98.8	hCG96198, isofo...	Homo sapiens
XP_876015	1.4e-181	83.9	similar to hCG9...	Bos taurus
EDL19086	2.5e-167	78.2	zinc finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	947	959	PR01217	NULL
	NULL	962	978	PR01217	NULL
	NULL	983	995	PR01217	NULL
	NULL	1002	1023	PR01217	NULL
	NULL	1036	1052	PR01217	NULL

Primer_f	CAGACTTGGGATGAACATGAG
Primer_r	CCAGCACTGTCCGAAAACTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-