ROUGE

Gene/Protein Characteristic Table for mKIAA1841

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129454
Description :
Clone Name :	mbh03589 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4107 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1705 bp

Genome contig ID gi65527427r_23368567
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
ACTTATTGAAATAAATGGCAATGACAAAAATTGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGAAAGTCCCTTGATCTGACTTGTTCTGCTGTCTGAGGAGACTGGAGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1841 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1841	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 243..2402
Length: 719 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH79876	0	99.9	RIKEN cDNA 0610...	Mus musculus
AAH72622	0	98.0	0610010F05Rik p...	Mus musculus
CAM16942	0	100.0	novel protein [...	Mus musculus
EDL07891	2.4e-156	100.0	RIKEN cDNA 0610...	Mus musculus
BAD18445	2.9e-131	88.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1705 bp
Genome contig ID	gi65527427r_23368567
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ACTTATTGAAATAAATGGCAATGACAAAAATTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGAAAGTCCCTTGATCTGACTTGTTCTGCTGTCTGAGGAGACTGGAGTG

Gene/Protein Characteristic Table for mKIAA1841

Features of the cloned DNA sequence

Features of the protein sequence