ROUGE

Gene/Protein Characteristic Table for mKIAA1824

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122561
Description :	WD-repeat protein 22.
Clone Name :	mbg09179 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5543 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2662 bp

Genome contig ID gi65532617r_77096561
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCTCTGTATATGCAAATAAACCTATTAATCACTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCCTGCCTTCCTCCTCTCTTCCTGGGAAGACTTGGTTGCTTAGACACCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1824 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1824	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2881
Length: 959 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL02662	100.0	WD repeat domai...	Mus musculus
Q80T85	100.0	WD repeat-conta...	Mus musculus
XP_234345	95.4	similar to WD-r...	Rattus norvegicus
AAH42567	100.0	Wdr22 protein [...	Mus musculus
EDM03743	95.5	WD repeat domai...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC064045	0.00038	25.2	mKIAA4167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 62 96 PD000018 WD-40 repeat

FPrintScan IPR001680 82 96 PR00320 WD-40 repeat

IPR001680 171 185 PR00320 WD-40 repeat

IPR001680 308 322 PR00320 WD-40 repeat

HMMPfam IPR001680 57 95 PF00400 WD-40 repeat

IPR001680 105 142 PF00400 WD-40 repeat

IPR001680 146 184 PF00400 WD-40 repeat

IPR001680 283 321 PF00400 WD-40 repeat

IPR001680 337 374 PF00400 WD-40 repeat

HMMSmart IPR001680 55 95 SM00320 WD-40 repeat

IPR001680 103 142 SM00320 WD-40 repeat

IPR001680 145 184 SM00320 WD-40 repeat

IPR001680 192 229 SM00320 WD-40 repeat

IPR001680 277 321 SM00320 WD-40 repeat

IPR001680 335 374 SM00320 WD-40 repeat

ProfileScan IPR001680 62 104 PS50082 WD-40 repeat

IPR001680 62 374 PS50294 WD-40 repeat

IPR001680 151 186 PS50082 WD-40 repeat

IPR001680 342 374 PS50082 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	62	96	PD000018	WD-40 repeat
FPrintScan	IPR001680	82	96	PR00320	WD-40 repeat
IPR001680	171	185	PR00320	WD-40 repeat
IPR001680	308	322	PR00320	WD-40 repeat
HMMPfam	IPR001680	57	95	PF00400	WD-40 repeat
IPR001680	105	142	PF00400	WD-40 repeat
IPR001680	146	184	PF00400	WD-40 repeat
IPR001680	283	321	PF00400	WD-40 repeat
IPR001680	337	374	PF00400	WD-40 repeat
HMMSmart	IPR001680	55	95	SM00320	WD-40 repeat
IPR001680	103	142	SM00320	WD-40 repeat
IPR001680	145	184	SM00320	WD-40 repeat
IPR001680	192	229	SM00320	WD-40 repeat
IPR001680	277	321	SM00320	WD-40 repeat
IPR001680	335	374	SM00320	WD-40 repeat
ProfileScan	IPR001680	62	104	PS50082	WD-40 repeat
IPR001680	62	374	PS50294	WD-40 repeat
IPR001680	151	186	PS50082	WD-40 repeat
IPR001680	342	374	PS50082	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2662 bp
Genome contig ID	gi65532617r_77096561
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCTCTGTATATGCAAATAAACCTATTAATCACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCTGCCTTCCTCCTCTCTTCCTGGGAAGACTTGGTTGCTTAGACACCC

Gene/Protein Characteristic Table for mKIAA1824

Features of the cloned DNA sequence

Features of the protein sequence