ROUGE |
Gene/Protein Characteristic Table for mKIAA1814 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220271 |
---|---|
histone H3 methyltransferase DOT1. histone methyltransferase DOT1L. |
|
mia46074 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7688 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4288 bp Genome contig ID gi65524842f_80786938 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAGGAGGAAAAATACTTTTATTTATTCAAATGCACFlanking genome sequence
(139441 - 139490) ----+----*----+----*----+----*----+----*----+----*
AAAAACGAAAAAAAAAAAAATGGCACTGGCCAGGGACCCTGCAGGAGTGT
KIAA Alignment based on: KIAA1814 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 695..3385, 3400..4812, 5394..5987
Length: 1565 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |