ROUGE |
Gene/Protein Characteristic Table for mKIAA1810 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122558 |
---|---|
HRD1 protein. synoviolin 1. |
|
mbh02539 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3917 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1992 bp Genome contig ID gi65553144f_5735852 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTGTATATACAGCTCAATAAAAACTTGCATTAATGFlanking genome sequence
(106652 - 106701) ----+----*----+----*----+----*----+----*----+----*
ATTGGTAGAACGTGTCACCTAGGGTAGGGCTGGGCTCTTAGTCTACAGAC
KIAA Alignment based on: KIAA1810 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 44..550, 1221..1817, 2085..2684
Length: 568 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |