Gene/Protein Characteristic Table for mKIAA1805

Length: 3270 bp

Restriction map

Length of 3'UTR	1494 bp
Genome contig ID	gi65498774f_29811400
PolyA signal sequence (AATAAA,-19)	+----*----+----*----+----*----+---- TGGAGAATATTTGACAAATAAAATGACTCTCTCAG
Flanking genome sequence (129292 - 129341)	----+----*----+----*----+----*----+----*----+----* AAAGTCTCTGGTCCTCCTTGCTGCCACTCTGCTCTCGGACACCTTGCTGA

KIAA	Alignment based on:
KIAA1805	DNA sequence, AA sequence, Physical map

Coding region: 1..1776

Length: 591 aa

Entry Exp ID% Protein Source Q69Z99 2.6e-209 100.0 Zinc finger pro... Mus musculus BAE27105 5.1e-209 99.8 unnamed protein... Mus musculus BAE29168 5.1e-209 99.8 unnamed protein... Mus musculus BAC39137 1.4e-208 99.6 unnamed protein... Mus musculus BAE32924 3.6e-208 99.6 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129308 6e-43 38.1 mKIAA1196

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	319	342	PF00096	Zinc finger
	IPR007087	471	494	PF00096	Zinc finger
HMMSmart	IPR007087	229	252	SM00355	Zinc finger
	IPR007087	319	342	SM00355	Zinc finger
	IPR007087	437	459	SM00355	Zinc finger
	IPR007087	471	494	SM00355	Zinc finger
ProfileScan	IPR007087	319	342	PS50157	Zinc finger
	IPR007087	471	499	PS50157	Zinc finger
ScanRegExp	IPR007087	231	252	PS00028	Zinc finger
	IPR007087	321	342	PS00028	Zinc finger
	IPR007087	473	494	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-