ROUGE

Gene/Protein Characteristic Table for mKIAA1803

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173266
Description :	zinc finger protein 462. gene trap insertion site 4-2.
Clone Name :	mfj24209 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4816 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2697 bp

Genome contig ID gi65493515f_54829285
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GATGTGAGAAATTAATAAAGAATTTTTTCACATGT
Flanking genome sequence
(170159 - 170208)
----+----*----+----*----+----*----+----*----+----*
ATTTATGTGCATCTGTTAAGTTATTTGTGGGTGTGATTACAGACAGGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1803 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1803	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2119
Length: 705 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM19594	99.6	zinc finger pro...	Mus musculus
ABC79685	99.6	zinc finger pro...	Mus musculus
XP_342841	97.2	similar to zinc...	Rattus norvegicus
XP_001109263	93.5	zinc finger pro...	Macaca mulatta
AAH36884	93.3	ZNF462 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122500	1.2e-07	26.5	mKIAA1388
AK129467	9e-07	24.8	mKIAA1948
AK172933	1.8e-06	23.5	mKIAA0326
AK173278	3.2e-06	23.1	mKIAA1852
AK220562	1.9e-05	23.8	mKIAA4236

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 91 113 PF00096 Zinc finger

IPR007087 224 246 PF00096 Zinc finger

IPR007087 253 276 PF00096 Zinc finger

IPR007087 499 521 PF00096 Zinc finger

IPR007087 527 550 PF00096 Zinc finger

IPR007087 613 635 PF00096 Zinc finger

HMMSmart IPR007087 45 69 SM00355 Zinc finger

IPR007087 91 113 SM00355 Zinc finger

IPR007087 167 189 SM00355 Zinc finger

IPR007087 224 246 SM00355 Zinc finger

IPR007087 253 276 SM00355 Zinc finger

IPR007087 282 305 SM00355 Zinc finger

IPR007087 390 413 SM00355 Zinc finger

IPR007087 419 442 SM00355 Zinc finger

IPR007087 453 475 SM00355 Zinc finger

IPR007087 499 521 SM00355 Zinc finger

IPR007087 527 550 SM00355 Zinc finger

IPR007087 613 635 SM00355 Zinc finger

ProfileScan IPR007087 91 118 PS50157 Zinc finger

IPR007087 224 252 PS50157 Zinc finger

IPR007087 253 281 PS50157 Zinc finger

IPR007087 499 526 PS50157 Zinc finger

IPR007087 527 555 PS50157 Zinc finger

IPR007087 613 635 PS50157 Zinc finger

ScanRegExp IPR007087 93 113 PS00028 Zinc finger

IPR007087 501 521 PS00028 Zinc finger

IPR007087 615 635 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	91	113	PF00096	Zinc finger
IPR007087	224	246	PF00096	Zinc finger
IPR007087	253	276	PF00096	Zinc finger
IPR007087	499	521	PF00096	Zinc finger
IPR007087	527	550	PF00096	Zinc finger
IPR007087	613	635	PF00096	Zinc finger
HMMSmart	IPR007087	45	69	SM00355	Zinc finger
IPR007087	91	113	SM00355	Zinc finger
IPR007087	167	189	SM00355	Zinc finger
IPR007087	224	246	SM00355	Zinc finger
IPR007087	253	276	SM00355	Zinc finger
IPR007087	282	305	SM00355	Zinc finger
IPR007087	390	413	SM00355	Zinc finger
IPR007087	419	442	SM00355	Zinc finger
IPR007087	453	475	SM00355	Zinc finger
IPR007087	499	521	SM00355	Zinc finger
IPR007087	527	550	SM00355	Zinc finger
IPR007087	613	635	SM00355	Zinc finger
ProfileScan	IPR007087	91	118	PS50157	Zinc finger
IPR007087	224	252	PS50157	Zinc finger
IPR007087	253	281	PS50157	Zinc finger
IPR007087	499	526	PS50157	Zinc finger
IPR007087	527	555	PS50157	Zinc finger
IPR007087	613	635	PS50157	Zinc finger
ScanRegExp	IPR007087	93	113	PS00028	Zinc finger
IPR007087	501	521	PS00028	Zinc finger
IPR007087	615	635	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2697 bp
Genome contig ID	gi65493515f_54829285
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GATGTGAGAAATTAATAAAGAATTTTTTCACATGT
Flanking genome sequence (170159 - 170208)	----+--------+--------+--------+--------+----* ATTTATGTGCATCTGTTAAGTTATTTGTGGGTGTGATTACAGACAGGAAG

Gene/Protein Characteristic Table for mKIAA1803

Features of the cloned DNA sequence

Features of the protein sequence