ROUGE

Gene/Protein Characteristic Table for mKIAA1795

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129442
Description :	Mblk1-related protein-2. transcription factor MLR2.
Clone Name :	mpg00446 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4564 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2966 bp

Genome contig ID gi65553144f_40972932
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGATAGTGGCCCCTTTTAAAATTCATGAGCCTCTC
Flanking genome sequence
(133689 - 133738)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACTTAAAAAAATACAAAAGCTGCTGAATATTTCAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1795 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1795	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1598
Length: 531 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_543946	2.7e-186	96.8	similar to liga...	Canis lupus fam...
XP_345034	3.6e-182	95.3	similar to Mblk...	Rattus norvegicus
XP_001054322	3.8e-182	95.3	similar to Mblk...	Rattus norvegicus
XP_001093998	5.5e-177	97.0	similar to liga...	Macaca mulatta
Q6ZPI3	6.6e-154	100.0	Ligand-dependen...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007889 448 493 PF05225 Helix-turn-helix

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007889	448	493	PF05225	Helix-turn-helix

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2966 bp
Genome contig ID	gi65553144f_40972932
PolyA signal sequence (None)	+--------+--------+----*----+---- AGATAGTGGCCCCTTTTAAAATTCATGAGCCTCTC
Flanking genome sequence (133689 - 133738)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAACTTAAAAAAATACAAAAGCTGCTGAATATTTCAAA

Gene/Protein Characteristic Table for mKIAA1795

Features of the cloned DNA sequence

Features of the protein sequence