ROUGE |
Gene/Protein Characteristic Table for mKIAA1787 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173264 |
---|---|
Similar to G protein pathway suppressor 2 (Fragment). | |
mpg02878 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4762 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 493 bp Genome contig ID gi65527427f_69528802 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TCTAAGGAGCCAATAAATACTGTCTTCAGAGCATCFlanking genome sequence
(110683 - 110732) ----+----*----+----*----+----*----+----*----+----*
TGCCTCCGCCTCTGTCTCCCGCGGCCTCGCGAGTGAAGAGTTCTAGGGGC
KIAA Alignment based on: KIAA1787 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..4269
Length: 1422 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |