ROUGE

Gene/Protein Characteristic Table for mKIAA1784

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173263
Description :
Clone Name :	mbg02269 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5116 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 697 bp

Genome contig ID gi65546577r_3550717
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
GACTTTATTTAAAAATAAATAAATAAATAAACTAG
Flanking genome sequence
(99974 - 99925)
----+----*----+----*----+----*----+----*----+----*
ACACTCCTCTCTGAGAAAACCACCGGGAACACACAGTGAGCTTGGGCCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1784 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1784	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 280..4419
Length: 1379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH65125	0	100.0	BTB (POZ) domai...	Mus musculus
XP_220211	0	80.2	similar to BTB ...	Rattus norvegicus
XP_001079342	0	80.2	similar to BTB ...	Rattus norvegicus
EDK97216	0	100.0	mCG126175 [Mus ...	Mus musculus
XP_589654	1e-132	53.0	similar to BTB ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000210 310 423 PF00651 BTB/POZ

HMMSmart IPR000210 320 423 SM00225 BTB/POZ

ProfileScan IPR000210 320 393 PS50097 BTB/POZ

NULL 425 484 PS50313 NULL

NULL 647 694 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000210	310	423	PF00651	BTB/POZ
HMMSmart	IPR000210	320	423	SM00225	BTB/POZ
ProfileScan	IPR000210	320	393	PS50097	BTB/POZ
NULL	425	484	PS50313	NULL
NULL	647	694	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	697 bp
Genome contig ID	gi65546577r_3550717
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GACTTTATTTAAAAATAAATAAATAAATAAACTAG
Flanking genome sequence (99974 - 99925)	----+--------+--------+--------+--------+----* ACACTCCTCTCTGAGAAAACCACCGGGAACACACAGTGAGCTTGGGCCCC

Gene/Protein Characteristic Table for mKIAA1784

Features of the cloned DNA sequence

Features of the protein sequence