| ROUGE |
Gene/Protein Characteristic Table for mKIAA1763 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173255 |
|---|---|
| Contactin associated protein-like 4 precursor. | |
| mfj36281 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4542 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 542 bp Genome contig ID gi65515060f_111766959 PolyA signal sequence
(AATACA,-17)
TTTCTCTGTATTACATTCAATACATCAATAGTCTGFlanking genome sequence
(413941 - 413990)
AAAAATTGTTTTCTTGTCTTTGGCTTGTTTGTATTGCTCTTTTTCTATTT
KIAA Alignment based on: KIAA1763 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 8..4000
Length: 1330 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
