ROUGE |
Gene/Protein Characteristic Table for mKIAA1760 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129439 |
---|---|
Similar to protein kinase, lysine deficient 1 (Fragment). | |
mbh02336 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4367 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 368 bp Genome contig ID gi65535943r_48537364 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
GTGAAGGAGAAAAATAAACATTTGCTTGAAAATACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGTGAAATGGCAGCTTTTGTTCTTGCCCCCTACTTACATCAAAGCCAAGC
KIAA Alignment based on: KIAA1760 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..3999
Length: 1332 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR000694 | 36 | 222 | PS50099 | Proline-rich region |
IPR000694 | 572 | 638 | PS50099 | Proline-rich region |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |