ROUGE

Gene/Protein Characteristic Table for mKIAA1760

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129439
Description :	Similar to protein kinase, lysine deficient 1 (Fragment).
Clone Name :	mbh02336 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4367 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 368 bp

Genome contig ID gi65535943r_48537364
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GTGAAGGAGAAAAATAAACATTTGCTTGAAAATAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTGAAATGGCAGCTTTTGTTCTTGCCCCCTACTTACATCAAAGCCAAGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1760 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1760	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3999
Length: 1332 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH60187	92.5	Wnk2 protein [M...	Mus musculus
AAH46464	95.9	Wnk2 protein [M...	Mus musculus
Q3UH66	91.5	Serine/threonin...	Mus musculus
XP_225204	87.4	similar to WNK ...	Rattus norvegicus
NP_083637	85.8	WNK lysine defi...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 36 222 PS50099 Proline-rich region

IPR000694 572 638 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	36	222	PS50099	Proline-rich region
IPR000694	572	638	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	368 bp
Genome contig ID	gi65535943r_48537364
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTGAAGGAGAAAAATAAACATTTGCTTGAAAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGAAATGGCAGCTTTTGTTCTTGCCCCCTACTTACATCAAAGCCAAGC

Gene/Protein Characteristic Table for mKIAA1760

Features of the cloned DNA sequence

Features of the protein sequence