ROUGE

Gene/Protein Characteristic Table for mKIAA1746

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173250
Description :
Clone Name :	mic07065 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 3722 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 508 bp

Genome contig ID gi65515060f_105878801
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAATTACCTTGGCTGGAATGATCAGCCAATGTG
Flanking genome sequence
(269752 - 269801)
----+----*----+----*----+----*----+----*----+----*
AATGCTGTCACCGAGCTGGTTGACTTTTGCAGAAGAAGAGTAAGCCCTGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1746 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1746	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3214
Length: 1070 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8C3S2	99.4	Transmembrane a...	Mus musculus
AAH66869	99.3	Transmembrane a...	Mus musculus
EDL11376	99.1	expressed seque...	Mus musculus
EDL11375	99.1	expressed seque...	Mus musculus
EDL11374	98.9	expressed seque...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 928 964 PF02985 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	928	964	PF02985	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	508 bp
Genome contig ID	gi65515060f_105878801
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAATTACCTTGGCTGGAATGATCAGCCAATGTG
Flanking genome sequence (269752 - 269801)	----+--------+--------+--------+--------+----* AATGCTGTCACCGAGCTGGTTGACTTTTGCAGAAGAAGAGTAAGCCCTGT

Gene/Protein Characteristic Table for mKIAA1746

Features of the cloned DNA sequence

Features of the protein sequence