KIAA1746

Product ID	ORK02050
Accession No	AB051533
Description	transport and golgi organization 6 homolog
Clone name	pj01729
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4816 bp) Predicted protein sequence (1098 aa)
HaloTag ORF Clone	FHC02050
Flexi ORF Clone	FXC02050
Source	Human brain (hippocampus)
Rouge ID	mKIAA1746 by Kazusa Mouse cDNA Project

Length: 4816 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1519 bp
Genome contig ID	gi51511732f_67335010
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- GTACAATAAAAATGCTTGTTTCTTGGCCTTCCTTT
Flanking genome sequence (341576 - 341625)	----+--------+--------+--------+--------+----* AACTAGACTCCACGCAACCCACTTCAGACCAGCAGATCGAATGTGTTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	67435010	67676584	18	99.6	Perfect prediction

Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0B7	100.0	Transmembrane a...	Homo sapiens
XP_001092854	93.1	similar to T16G...	Macaca mulatta
XP_001497099	89.0	transmembrane a...	Equus caballus
BAG53028	100.0	unnamed protein...	Homo sapiens
CAH92918	97.4	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	877	913	PF02985	HEAT
HMMPfam	IPR000357	956	992	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	150	QFVLQFVVTLGICPYLMPGVGV	171	PRIMARY	22

Primer_f	AACCTTTGATCCATACCTTCC
Primer_r	AGCTCTGCGTACTTGAACTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-