ROUGE

Gene/Protein Characteristic Table for mKIAA1741

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129436
Description :	182 kDa tankyrase 1-binding protein (Fragment).
Clone Name :	mpg01173 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4436 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 460 bp

Genome contig ID gi66880554f_84656268
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACTTGAAACAATGAATAAAGTTTTTTGGGAATTGG
Flanking genome sequence
(114528 - 114577)
----+----*----+----*----+----*----+----*----+----*
GGTTGTCCAGGATTGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1741 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1741	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3976
Length: 1324 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50948	100.0	Tankyrase 1 bin...	Mus musculus
P58871	99.9	182 kDa tankyra...	Mus musculus
EDL27317	100.0	mCG3560, isofor...	Mus musculus
CAM22340	99.9	tankyrase 1 bin...	Mus musculus
EDL27316	99.9	mCG3560, isofor...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220411	5.4e-06	34.2	mKIAA1671

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	460 bp
Genome contig ID	gi66880554f_84656268
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTTGAAACAATGAATAAAGTTTTTTGGGAATTGG
Flanking genome sequence (114528 - 114577)	----+--------+--------+--------+--------+----* GGTTGTCCAGGATTGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG

Gene/Protein Characteristic Table for mKIAA1741

Features of the cloned DNA sequence

Features of the protein sequence