ROUGE

Gene/Protein Characteristic Table for mKIAA1737

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122546
Description :
Clone Name :	mbh04080 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4027 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2695 bp

Genome contig ID gi65532617f_83721049
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TCAAAGAAAAAAATAAAAGTCACTTACTTGAAAGC
Flanking genome sequence
(118098 - 118147)
----+----*----+----*----+----*----+----*----+----*
AATTTGGTCTATTTGCTTTGTAACTGCTTAAAAATTTTAAGGCCTGGGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1737 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1737	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1332
Length: 443 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL02913	3e-144	100.0	RIKEN cDNA 2310...	Mus musculus
BAE35935	2.8e-143	99.8	unnamed protein...	Mus musculus
BAE32612	6.6e-143	99.3	unnamed protein...	Mus musculus
BAE28540	5.4e-138	100.0	unnamed protein...	Mus musculus
AAH26384	1.2e-131	100.0	RIKEN cDNA 2310...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2695 bp
Genome contig ID	gi65532617f_83721049
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TCAAAGAAAAAAATAAAAGTCACTTACTTGAAAGC
Flanking genome sequence (118098 - 118147)	----+--------+--------+--------+--------+----* AATTTGGTCTATTTGCTTTGTAACTGCTTAAAAATTTTAAGGCCTGGGCC

Gene/Protein Characteristic Table for mKIAA1737

Features of the cloned DNA sequence

Features of the protein sequence