ROUGE

Gene/Protein Characteristic Table for mKIAA1735

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129432
Description :	DIX domain containing 1.
Clone Name :	mpm03353 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4896 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3441 bp

Genome contig ID gi65519420r_50635082
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CACACACACTATGAATAAAATGGAGTTTGCAAACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATCCACTTCTTCATTTTCATTTCTATCTCTTCCCTGAGATGAGCAGTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1735 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1735	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1455
Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAT41660	8.1e-161	99.6	Ccd1Aalpha1L [M...	Mus musculus
Q80Y83	8.1e-161	99.6	Dixin; DIX doma...	Mus musculus
AAT41663	9.1e-155	98.5	Ccd1BbetaL [Mus...	Mus musculus
AAT41662	1.3e-154	98.3	Ccd1BalphaL [Mu...	Mus musculus
XP_850708	2e-148	90.6	similar to DIX ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001158 402 484 PD003639 DIX

HMMPfam IPR001158 399 481 PF00778 DIX

HMMSmart IPR001158 399 481 SM00021 DIX

ProfileScan IPR001158 401 481 PS50841 DIX

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001158	402	484	PD003639	DIX
HMMPfam	IPR001158	399	481	PF00778	DIX
HMMSmart	IPR001158	399	481	SM00021	DIX
ProfileScan	IPR001158	401	481	PS50841	DIX

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3441 bp
Genome contig ID	gi65519420r_50635082
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CACACACACTATGAATAAAATGGAGTTTGCAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCCACTTCTTCATTTTCATTTCTATCTCTTCCCTGAGATGAGCAGTC

Gene/Protein Characteristic Table for mKIAA1735

Features of the cloned DNA sequence

Features of the protein sequence