ROUGE |
Gene/Protein Characteristic Table for mKIAA1715 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173241 |
---|---|
limb and neural patterns. lunapark. |
|
mph02652 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3101 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1699 bp Genome contig ID gi66880554r_74118112 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
ACGTGTCAATGATAGATTAAAGAAATGGAGAACTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTAGAATATAATCTTTTTATAAAAAGATGTGTTTATTTTTATTTTAT
KIAA Alignment based on: KIAA1715 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 122..1402
Length: 426 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |