ROUGE

Gene/Protein Characteristic Table for mKIAA1706

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173239
Description :
Clone Name :	mej02494 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 493 bp

Genome contig ID gi65519420f_25274881
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GAAAAAAGAAAAGAATAATAAACAGATTAATCTGC
Flanking genome sequence
(222550 - 222599)
----+----*----+----*----+----*----+----*----+----*
CTGGCTTCAGTCAGAGTGTGGAATGGTTTGCTTTGCTCTCTCACCTTAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1706 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1706	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 398..2221
Length: 607 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3TGW2	100.0	Endonuclease/ex...	Mus musculus
AAH25571	99.8	Endonuclease/ex...	Mus musculus
BAB26125	99.8	unnamed protein...	Mus musculus
Q5XI74	98.1	Endonuclease/ex...	Rattus norvegicus
XP_001103689	91.2	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000445 76 105 PF00633 Helix-hairpin-helix motif

IPR000445 173 202 PF00633 Helix-hairpin-helix motif

IPR005135 299 576 PF03372 Endonuclease/exonuclease/phosphatase

HMMSmart IPR003583 86 105 SM00278 Helix-hairpin-helix DNA-binding

IPR003583 116 135 SM00278 Helix-hairpin-helix DNA-binding

IPR003583 183 202 SM00278 Helix-hairpin-helix DNA-binding

HMMTigr IPR004509 76 138 TIGR00426 Competence protein ComEA helix-hairpin-helix region

ProfileScan IPR000445 75 105 PS50120 Helix-hairpin-helix motif

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000445	76	105	PF00633	Helix-hairpin-helix motif
IPR000445	173	202	PF00633	Helix-hairpin-helix motif
IPR005135	299	576	PF03372	Endonuclease/exonuclease/phosphatase
HMMSmart	IPR003583	86	105	SM00278	Helix-hairpin-helix DNA-binding
IPR003583	116	135	SM00278	Helix-hairpin-helix DNA-binding
IPR003583	183	202	SM00278	Helix-hairpin-helix DNA-binding
HMMTigr	IPR004509	76	138	TIGR00426	Competence protein ComEA helix-hairpin-helix region
ProfileScan	IPR000445	75	105	PS50120	Helix-hairpin-helix motif

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	493 bp
Genome contig ID	gi65519420f_25274881
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GAAAAAAGAAAAGAATAATAAACAGATTAATCTGC
Flanking genome sequence (222550 - 222599)	----+--------+--------+--------+--------+----* CTGGCTTCAGTCAGAGTGTGGAATGGTTTGCTTTGCTCTCTCACCTTAGT

Gene/Protein Characteristic Table for mKIAA1706

Features of the cloned DNA sequence

Features of the protein sequence