ROUGE

Gene/Protein Characteristic Table for mKIAA1637

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173226
Description :	Nuclear receptor coactivator 5.
Clone Name :	mid10003 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2930 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1222 bp

Genome contig ID gi66880554r_164357094
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TGAAATAATTACTTTTTAATTAAAATGAAAAAGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACCTGTGCTAATCTTTCTTGGGTGTGTCTGCAGCAGCACCTCTGCTGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1637 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1637	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 602..1708
Length: 368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC33631	6.7e-89	93.3	unnamed protein...	Mus musculus
Q91W39	8.5e-89	93.3	Nuclear recepto...	Mus musculus
EDL06441	9.4e-89	93.3	nuclear recepto...	Mus musculus
EDL96475	2.1e-88	92.7	nuclear recepto...	Rattus norvegicus
CAX16081	1.7e-87	100.0	nuclear recepto...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1222 bp
Genome contig ID	gi66880554r_164357094
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TGAAATAATTACTTTTTAATTAAAATGAAAAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACCTGTGCTAATCTTTCTTGGGTGTGTCTGCAGCAGCACCTCTGCTGA

Gene/Protein Characteristic Table for mKIAA1637

Features of the cloned DNA sequence

Features of the protein sequence