ROUGE |
Gene/Protein Characteristic Table for mKIAA1616 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173218 |
---|---|
MELASTATIN 2 homolog. | |
mib26058 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6287 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1084 bp Genome contig ID gi65553144f_21276974 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCATACCGCTCATCATGTGACCATTTTGTATTTGFlanking genome sequence
(950342 - 950391) ----+----*----+----*----+----*----+----*----+----*
AACACATGGTTATATGTGGATATTTTCATACCTAGAGTTTTAGCCATCTA
KIAA Alignment based on: KIAA1616 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 47..5203
Length: 1718 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |