ROUGE

Gene/Protein Characteristic Table for mKIAA1604

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129404
Description :
Clone Name :	mpm02320 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4555 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3078 bp

Genome contig ID gi66880554r_77493523
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATCTTATGTTTTGTGAATAAAAGGAACAAATGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CATTGAATCATTGTCTTTTTTTCTAAAATATTTTTCTTTGTGTCAGTTTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1604 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1604	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 113..1447, 2779..3780, 3935..4321
Length: 907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM19372	97.6	novel protein [...	Mus musculus
CAM19371	97.5	novel protein [...	Mus musculus
EDL27232	96.9	cDNA sequence B...	Mus musculus
BAE20931	97.4	unnamed protein...	Mus musculus
BAE28941	97.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003890 166 349 PF02854 Initiation factor eIF-4 gamma

IPR003891 458 564 PF02847 Initiation factor eIF-4 gamma

HMMSmart IPR003890 166 349 SM00543 Initiation factor eIF-4 gamma

IPR003891 458 564 SM00544 Initiation factor eIF-4 gamma

ProfileScan NULL 19 108 PS50323 NULL

NULL 673 717 PS50324 NULL

NULL 746 899 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	166	349	PF02854	Initiation factor eIF-4 gamma
IPR003891	458	564	PF02847	Initiation factor eIF-4 gamma
HMMSmart	IPR003890	166	349	SM00543	Initiation factor eIF-4 gamma
IPR003891	458	564	SM00544	Initiation factor eIF-4 gamma
ProfileScan	NULL	19	108	PS50323	NULL
NULL	673	717	PS50324	NULL
NULL	746	899	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3078 bp
Genome contig ID	gi66880554r_77493523
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATCTTATGTTTTGTGAATAAAAGGAACAAATGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATTGAATCATTGTCTTTTTTTCTAAAATATTTTTCTTTGTGTCAGTTTC

Gene/Protein Characteristic Table for mKIAA1604

Features of the cloned DNA sequence

Features of the protein sequence