ROUGE

Gene/Protein Characteristic Table for mKIAA1600

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122530
Description :
Clone Name :	mbg03593 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5108 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3017 bp

Genome contig ID gi65553144f_56856960
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AAATCAAGAAAAATAAATCAATGTAACTTAAACAG
Flanking genome sequence
(118360 - 118409)
----+----*----+----*----+----*----+----*----+----*
AACATTGTCGTATATTTTTGTAGAATTCTAACTGAAAACGTTTTACCCAC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1600 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1600	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2091
Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8CDM8	100.0	UPF0518 protein...	Mus musculus
EDL01780	100.0	expressed seque...	Mus musculus
BAC26638	99.9	unnamed protein...	Mus musculus
BAE42971	99.3	unnamed protein...	Mus musculus
EDL94517	97.1	LOC361774 (pred...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122552	0.00033	27.8	mKIAA1759

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3017 bp
Genome contig ID	gi65553144f_56856960
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAATCAAGAAAAATAAATCAATGTAACTTAAACAG
Flanking genome sequence (118360 - 118409)	----+--------+--------+--------+--------+----* AACATTGTCGTATATTTTTGTAGAATTCTAACTGAAAACGTTTTACCCAC

Gene/Protein Characteristic Table for mKIAA1600

Features of the cloned DNA sequence

Features of the protein sequence